miRNA display CGI


Back To miRNA display CGI home

Results 1 - 20 of 337 are showing below:
Show page:

Candidate ID Hairpin Sequence Mature Sequence Chromosome No. Strand Start Length Version
dre-mir-31 GAAGAGAUGGCAAGAUGUUGGCAUAGCUGUUAAUGUUUAUGGGCCUGCUAUGCCUCCAUAUUGCCAUUUCUG GGCAAGAUGUUGGCAUAGCUG 0 0 miRBase 9.0
dre-mir-30a GGCUCCUUGCAGUUGUAAACAUUCCCGACUGGAAGUUGUAAUGCAGAAAAUCUCAGCUUUCAGUCUGAUGUUUGCUGCUACUGGUGGCC UGUAAACAUUCCCGACUGGAAG 0 0 miRBase 9.0
dre-mir-139 CUGUAUUCUACAGUGCAUGUGUCUCCAGUGUUUCUAUGGCGACUGGGGAGGCAGCGCUGUUGGAAUAAC UCUACAGUGCAUGUGUCU 0 0 miRBase 9.0
dre-mir-430j CAGUUGAGAUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAAUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAAUUGGGGUA 0 0 miRBase 9.0
dre-mir-221 GUCGUGAACCUGGCAUACAAUGUAGAUUUCUGUGUGGUACUAUCUACAGCUACAUUGUCUGCUGGGUUUCAGGCCAGCAGAAUAAUUCUGCUC AGCUACAUUGUCUGCUGGGUUUC 0 0 miRBase 9.0
dre-mir-222 GCCGGUGGCUUGUUCGGGUGCUCAUGAGAUGCUCAGUAGUCAGUGUAGAUCCUGUGUCACAAUCAGCAGCUACAUCUGGCUACUGGGUCUCUGAUGGCAUUUUCUGCU AGCUACAUCUGGCUACUGGGUCUC 0 0 miRBase 9.0
dre-mir-220 GACAGUGUGGCGUUGUAGGGCUCCACAACCGUAUCGGACACUUUGGGAGACGGCACCACACUGAAGGUGUUCAUGAUGCGGUCCGGAAACUCCUCGCGGAUCUUACUGAUG CCACAACCGUAUCGGACACUU 1 + 65180784 0 miRBase 9.0
dre-mir-16b CCUGAACUUGGCCGUGUGACAGACUGGCUGCCUGGCUGUAGCAGCACGUAAAUAUUGGAGUCAAAGCACUUGCGAAUCCUCCAGUAUUGACCGUGCUGCUGGAGUUAGGCGGGCCGUUUACCGUCUGCGGGGGCCUCGGG UAGCAGCACGUAAAUAUUGGAG 1 - 58022936 0 miRBase 9.0
dre-mir-218a-2 GCGGGGUUUUCCUUUGUGCUUGAUCUAACCAUGUGGUUGCAGACUCAGACUAAUACAUGGUUCUGUCAAGCACCAUGGAAGGUCUUGC UUGUGCUUGAUCUAACCAUGUG 1 - 31788400 0 miRBase 9.0
dre-mir-15a-1 CCUGUCGGUACUGUAGCAGCACAGAAUGGUUUGUGAGUUAUAACGGGGGUGCAGGCCGUACUGUGCUGCGGCAACAACGACAGG UAGCAGCACAGAAUGGUUUGUG 1 - 58023179 0 miRBase 9.0
dre-mir-722 GGAACGGAGUGGAAUUUGAAACGUUUUGGCCAAAAAUGUAGCCAUGGCAAAGGGGUUUUUUGCAGAAACGUUUCAGAUUUCGCUCCGUUCU UUUUUUGCAGAAACGUUUCAGAUU 1 - 65328462 0 miRBase 9.0
dre-mir-155 UGGUGCAGGUUUAAUGCUAAUCGUGAUAGGGGUUUAGUGCUGAUGAACACCUAUGCUGUUAGCAUUAAUCUUGCGCUA UUAAUGCUAAUCGUGAUAGGGG 1 - 1074307 0 miRBase 9.0
dre-mir-740 GCAUUUGUGUGCAUAAAAAGUGGUAUGGUACAGUUUGCUUUUAGGUACUUUUUGACAGUGGAAUCAGCCAUAAAAGCGUACUGUACCGUACCAUACCGUAUGGUACCAGGGGC AUAAAAAGUGGUAUGGUACAGU 1 + 46366888 0 miRBase 9.0
dre-mir-130a-1 UGUCUGUCCAGUGCCCCUUUUAUAUUGUACUACUGAUAACCCAGUUAUUAAAGCAGUGCAAUGUUAAAAGGGCAUUGGCCAGGGA CAGUGCAAUGUUAAAAGGGCAU 10 + 33274859 0 miRBase 9.0
dre-let-7c-2 GUGUGCAUCCAGGCUGAGGUAGUAGGUUGUAUGGUUUCGAAUGACACCAUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGUACAC UGAGGUAGUAGGUUGUAUGGUU 10 - 36836846 0 miRBase 9.0
dre-mir-301a-2 GCUGUUAACAGGUGCUCUGACUUCAUUGCACUACUGUAUUGGACAGCUAGCAGUGCAAUAGUAUUGUCAAAGCGUCUGAGAGCAGC CAGUGCAAUAGUAUUGUCAAAG 10 + 33528786 0 miRBase 9.0
dre-mir-430a-1 CUGCUACUGUUGUCACUAUCGGUGCCCUCACAAAGGCACUGACUUGGAUGCUGCAUGUGGUAAGUGCUAUUUGUUGGGGUAGUUUCAAGUGACCUGUGCUA UAAGUGCUAUUUGUUGGGGUAG 10 - 5642094 0 miRBase 9.0
dre-mir-125b-3 CCCGUGCGGCCACCGCUGCACUCCUCCUGGUCCCUGAGACCCUAACUUGUGAGCUUUGUGUGCUAAAAAUCACAGGUUAAGCUCUUGGGACCUGGGCAGAGGGCAAAAGCACUGG UCCCUGAGACCCUAACUUGUGA 10 - 36817602 0 miRBase 9.0
dre-mir-132-2 UCCCUUCCUCUGCUGUCUCCAUGCUGACCGUGGCUUUAGAUUGUUACUGUAGCGUUGGCACGUGGUAACAGUCUACAGCCAUGGUCGCCAAGGGGCAGGUGUUACAGCGACUACUGGGA UAACAGUCUACAGCCAUGGUCG 10 + 39219002 0 miRBase 9.0
dre-mir-194a UGGUGCUGACUGCUUGUAACAGCAACUCCAUGUGGAAGGUUUGUGUCUUCCAGUGGAGCUGCUGUUGCGUGCAGAUAGUCACCA UGUAACAGCAACUCCAUGUGG 10 + 26755494 0 miRBase 9.0

Download Known miRNA Sequences



TDL, Institute of Biomedical Science, Academia Sinica, Taipei, Taiwan.
Copyright © 2007 TDL. All rights reserved.