miRNA display CGI


Back To miRNA display CGI home

Results 1 - 20 of 337 are showing below:
Show page:

Candidate ID Hairpin Sequence Mature Sequence Chromosome No. Strand Start Length Version
dre-mir-205 AAACUACUGUGCAUUCUAUCCUUCAUUCCACCGGAGUCUGUGUAGUUGUUCAAUCAGAUUUCAGUGGUGUGAAGUGUAGGAAACACGGA UCCUUCAUUCCACCGGAGUCUG 23 + 51984364 0 miRBase 9.0
dre-mir-301b AAGGUCUGUUGCUUUGACGAUGUUGCACUACUGAACCAUCUAAUCAAGCAGUGCAAUAGUAUUGUCAUUGCAUUCGGCUUU CAGUGCAAUAGUAUUGUCAUUG 5 - 8268925 0 miRBase 9.0
dre-mir-365-3 AAGUCAGCAAGAAAAGUGAGGGACUUUUAGGGGCAGCUGUGUUAUACUGACCCAGUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCAGUGCUCAAC UAAUGCCCCUAAAAAUCCUUAU 6 - 50172169 0 miRBase 9.0
dre-mir-365-4 AAGUCAGCAAGAAAAGUGAGGGACUUUUAGGGGCAGCUGUGUUAUACUGACCCAGUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCAGUGCUCAAC UAAUGCCCCUAAAAAUCCUUAU 6 - 69345647 0 miRBase 9.0
dre-mir-133a-2 AAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCAACUGUUUUAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGUGCAUU UUUGGUCCCCUUCAACCAGCUG 23 - 6767167 0 miRBase 9.0
dre-mir-92a-2 ACAGCAUCCCUUUCUUUGCAGGUUGGGAUCGGCCGCAAUGCUCUGUGCUGGAAGUAUUGCACUUGUCCCGGCCUGUGAAGAGCAUGGGAAAUUGU UAUUGCACUUGUCCCGGCCUGU 9 - 50518173 0 miRBase 9.0
dre-mir-135a ACAGCUGUCGUGUCUUAUGGCUUUUUAUUCCUAUGUGAAGGUGAACAAGGCUCAUGUAGGGAUACAAGCCACUAAACACGCAGUCAGAAAUCAGCUUU UAUGGCUUUUUAUUCCUAUGUGA 21 + 30824370 0 miRBase 9.0
dre-mir-142b ACAGUGCAGUCACUCAUAAAGUAGACAGCACUACUAAACUUCUCUACACAGUGUAGUGUUUCCUACUUUAUGGAUGAGUGUACUGU CAUAAAGUAGACAGCACUACUA 9 + 40845673 0 miRBase 9.0
dre-mir-24-1 ACCUGAGCUCCGGUGCCUUCUGAGCUGAUAUCAGUUGUAGUAAAUCACUGGCUCAGUUCAGCAGGAACAGGAGUGUGGCC UGGCUCAGUUCAGCAGGAACAG 10 + 7238392 0 miRBase 9.0
dre-mir-216b-1 ACUGACUGGGUAAUCUCUGCAGGCAACUGUGAUGUGAUUACAGUCUCACAUUGACCUGAAGAGGUUGAGCAGUCUGU UAAUCUCUGCAGGCAACUGUGA 22 - 37342128 0 miRBase 9.0
dre-mir-489 ACUGACUUGAGUGGUGGCCUGGUGGUCGUAUGUAUGACGUCAUUUACUUCAAAGUUUGGAGUGACAUCAUAUGUACGGCUGCUAAACUGCUACAUGGCUCAUCA AGUGACAUCAUAUGUACGGCUGC 19 - 40674631 0 miRBase 9.0
dre-mir-499 ACUGAGAGGGAGGCAGUUAAGACUUGCAGUGAUGUUUAGAGAAAUGUCACAUGAACAUCACUUUAAGUCUGUGCUGGCUCCUGUUCUGAGU UUAAGACUUGCAGUGAUGUUUA 11 - 25948575 0 miRBase 9.0
dre-mir-21-2 AGACAGACAGUAAAAGUGUCCCUUUCUGUCAUGUAGCUUAUCAGACUGGUGUUGGCUUUGAGUUUUUGGCAACAGCAGUCUAAUAGGCUGUCUGACAUUUUGGGCUUAUUCGACGUACGGUUUGUUU UAGCUUAUCAGACUGGUGUUGGC 15 - 13199789 0 miRBase 9.0
dre-mir-451 AGAGGCGGCGAAACCGUUACCAUUACUGAGUUUAGUAAUGGUAAGGGUUCUGCUGCCUUU AAACCGUUACCAUUACUGAGUU 5 + 51571933 0 miRBase 9.0
dre-mir-732 AGAUAAAGUUCCACCGAGGGUUAAAUGUUUUGGUAUUUUAAUAGUGUCAAUCUCAAAGCAGAGAACUCUCGGUGGAGAUGUAUUU CUCAAAGCAGAGAACUCUCGGU 9 + 40256603 0 miRBase 9.0
dre-mir-100-2 AGCUGCCACAAACCCGUAGAUCCGAACUUGUGGUGUCUCUGUGCACAAGCUCGUGUCUAUAGGUAUGUGUCUGCG AACCCGUAGAUCCGAACUUGUG 5 - 26257728 0 miRBase 9.0
dre-mir-365-2 AGGCAGCAAGAAAAAUGAGGGACUUUUAGGGGCAGCUGUGUUUUAUUAACCCAGUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCAAUUUUCAGC UAAUGCCCCUAAAAAUCCUUAU 3 - 37146602 0 miRBase 9.0
dre-mir-219-1 AGGGUCCCAGAGAUUGAUUGUCCAAACGCAAUUCUUGUAACAUAUAAUAUAAAUCCAAGAAUUGUGCCUGGACAUCUGUUGCUGGAGAUUC UGAUUGUCCAAACGCAAUUCUU 10 - 10290020 0 miRBase 9.0
dre-mir-29a-2 AGGUUGACCGAUUUCUUUUGGUGUUCAGAGUCUUUUGGGGUUUCUAGCACCAUUUGAAAUCGGUUACAAUG UAGCACCAUUUGAAAUCGGUUA 23 - 16343564 0 miRBase 9.0
dre-mir-217-2 AUGAGAACUUUCUGAUGUUGGUGAUACUGCAUCAGGAACUGAUUGGAUGAUAUUCAGGAGCCAUCAGUUCCUGAUGCACUCCCAUCAGCAUCGAAAGA UACUGCAUCAGGAACUGAUUGG 22 + 37770216 0 miRBase 9.0

Download Known miRNA Sequences



TDL, Institute of Biomedical Science, Academia Sinica, Taipei, Taiwan.
Copyright © 2007 TDL. All rights reserved.