miRNA display CGI


Back To miRNA display CGI home

Results 1 - 20 of 337 are showing below:
Show page:

Candidate ID Hairpin Sequence Mature Sequence Chromosome No. Strand Start Length Version
dre-mir-301a-2 GCUGUUAACAGGUGCUCUGACUUCAUUGCACUACUGUAUUGGACAGCUAGCAGUGCAAUAGUAUUGUCAAAGCGUCUGAGAGCAGC CAGUGCAAUAGUAUUGUCAAAG 10 + 33528786 0 miRBase 9.0
dre-mir-375-1 UGCACUUGCUUUACGUUGAGCCACACGCACAAUACAUGUGGAUUCAGUUUUGUUCGUUCGGCUCGCGUUAAGCAAGUGCA UUUGUUCGUUCGGCUCGCGUUA 6 - 13423599 0 miRBase 9.0
dre-mir-375-2 UGUACUUGUCUCACGUUGAGCCACACGCACAAUGCCUGCAGAUGAAAGGGUUUUGUUCGUUCGGCUCGCGUUACGCAGAUGCA UUUGUUCGUUCGGCUCGCGUUA 9 - 10232524 0 miRBase 9.0
dre-mir-454a UUGCAGGUCGUUUAAGAAUUAAUCCUAAUUCUUGGGACCCUAUCAGUAUUGCCUCUGCUGUCCACUGUGUUCAGAGUAGUGCAAUAUUGCUAAUAGGGUUUUAGGUUUUAGGUUGUACCUUCAG UAGUGCAAUAUUGCUAAUAGGG 10 + 33275132 0 miRBase 9.0
dre-mir-454b GAUAAAUGCAUCUUGCAGGCGAGACCCUAUCAAUAUUGCCUCUGCUUUUCUCACUGUUUAUGGAGUAGUGCAAUAUUGCUUAUAGGGUCUUGACUUUAAGGCUAAUCUGCAAUAUC UAGUGCAAUAUUGCUUAUAGGG 5 - 8261936 0 miRBase 9.0
dre-mir-455 UCCCUGGUGUGAGGGUAUGUGCCCUUGGACUACAUCGUGGAAGCCAGCACCAUGCAGUCCAUGGGCAUAUACACUUGCCUCAAGGCCUAGAUCUUC UAUGUGCCCUUGGACUACAUCG 5 - 72011800 0 miRBase 9.0
dre-mir-430c-2 CACAUUAAGAUCACUUCAAACAGGAGCAUUGAUUUGUCCUUUGUUCAUAAGUGCUUCUCUUUGGGGUAGUUUUAAUAAG UAAGUGCUUCUCUUUGGGGUAG 4 + 11624772 0 miRBase 9.0
dre-mir-430c-3 CACAUUAAGAUCACUUCAAACAGGAGCAUUGAUUUGUCCUUUGUUCAUAAGUGCUUCUCUUUGGGGUAGUUUUAAUAAG UAAGUGCUUCUCUUUGGGGUAG 4 + 11625376 0 miRBase 9.0
dre-mir-430c-4 CACAUUAAGAUCACUUCAAACAGGAGCAUUGAUUUGUCCUUUGUUCAUAAGUGCUUCUCUUUGGGGUAGUUUUAAUAAG UAAGUGCUUCUCUUUGGGGUAG 4 + 11626514 0 miRBase 9.0
dre-mir-365-4 AAGUCAGCAAGAAAAGUGAGGGACUUUUAGGGGCAGCUGUGUUAUACUGACCCAGUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCAGUGCUCAAC UAAUGCCCCUAAAAAUCCUUAU 6 - 69345647 0 miRBase 9.0
dre-mir-365-3 AAGUCAGCAAGAAAAGUGAGGGACUUUUAGGGGCAGCUGUGUUAUACUGACCCAGUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCAGUGCUCAAC UAAUGCCCCUAAAAAUCCUUAU 6 - 50172169 0 miRBase 9.0
dre-mir-365-2 AGGCAGCAAGAAAAAUGAGGGACUUUUAGGGGCAGCUGUGUUUUAUUAACCCAGUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCAAUUUUCAGC UAAUGCCCCUAAAAAUCCUUAU 3 - 37146602 0 miRBase 9.0
dre-mir-301b AAGGUCUGUUGCUUUGACGAUGUUGCACUACUGAACCAUCUAAUCAAGCAGUGCAAUAGUAUUGUCAUUGCAUUCGGCUUU CAGUGCAAUAGUAUUGUCAUUG 5 - 8268925 0 miRBase 9.0
dre-mir-301c UGAGGUCAGCUGCUCUGACGAUGUUGCACUACUGUACCAUCCAUUCUAGCAGUGCAAUAGUAUUGUCAUAGCAUUUAGCCUCU CAGUGCAAUAGUAUUGUCAUAG 10 - 14103572 0 miRBase 9.0
dre-mir-338-1 GGUUUCUCCCUGCAACAAUCUCCUGAUGCUGCCUGAGUGUUUUUCUUCCACUCCAGCAUCAGUGAUUUUGUUGCCGGAGGUCACC UCCAGCAUCAGUGAUUUUGUUG 12 + 42871312 0 miRBase 9.0
dre-mir-338-2 GGUUUCUCCCUGCAACAAUCUCCUGAUGCUGCCUGAGUGUUUUUCUUCCACUCCAGCAUCAGUGAUUUUGUUGCCGGAGGUCACC UCCAGCAUCAGUGAUUUUGUUG 12 - 43127553 0 miRBase 9.0
dre-mir-338-3 GUGUGUGUGUGUGUUUCUGGUGCCUGCUGAGAACAAUAUCCUGAUGCUGAAUGAGUGUGUUGAAGGAAACUCCAGCAUCAGUGAUUUUGUUGCCAGAGGAGCACUUUGGGCAUCCUGUGUAUAU UCCAGCAUCAGUGAUUUUGUUG 12 + 15751785 0 miRBase 9.0
dre-mir-338-4 GUGUGUGUGUGUGUUUCUGGUGCCUGCUGAGAACAAUAUCCUGAUGCUGAAUGAGUGUGUUGAAGGAAACUCCAGCAUCAGUGAUUUUGUUGCCAGAGGAGCACUUUGGGCAUCCUGUGUAUAU UCCAGCAUCAGUGAUUUUGUUG 12 + 16453493 0 miRBase 9.0
dre-mir-363 UAAAUGCAAAUAUUUGUCUUGCUGUUUUCGGGUGGAUGACUCUGCAAUUUUAUUAGUGAUGGAAAAACUUCAAUAAAAAUUGCACGGUAUCCAUCUGUAAUCCGCUGGAUUCCAUUACCUGCGUUUG AAUUGCACGGUAUCCAUCUGUA 14 - 64027276 0 miRBase 9.0
dre-mir-365-1 CCGCAGGGAGAAUGAGGGGCUUUUGGGGGCACUUGUGUUUCAGUUUCACCAUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCACUG UAAUGCCCCUAAAAAUCCUUAU 24 - 11300495 0 miRBase 9.0

Download Known miRNA Sequences



TDL, Institute of Biomedical Science, Academia Sinica, Taipei, Taiwan.
Copyright © 2007 TDL. All rights reserved.