miRNA display CGI


Back To miRNA display CGI home

Results 1 - 20 of 337 are showing below:
Show page:

Candidate ID Hairpin Sequence Mature Sequence Chromosome No. Strand Start Length Version
dre-mir-93 GUGUGUGUUAAAAGUGCUGUUUGUGCAGGUAGUGUGUUUCCUCUACUGUAGGAGCAGCACUUCACAACACACAC AAAAGUGCUGUUUGUGCAGGUA 14 + 100078 0 miRBase 9.0
dre-mir-451 AGAGGCGGCGAAACCGUUACCAUUACUGAGUUUAGUAAUGGUAAGGGUUCUGCUGCCUUU AAACCGUUACCAUUACUGAGUU 5 + 51571933 0 miRBase 9.0
dre-mir-430j CAGUUGAGAUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAAUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAAUUGGGGUA 0 0 miRBase 9.0
dre-mir-430b-1 AUUGAUAGAAACCAGUUGAGGUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGC AAAGUGCUAUCAAGUUGGGGUAG 4 + 11627352 0 miRBase 9.0
dre-mir-430b-14 CAGUUGACAUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAGUUGGGGUAG 4 + 11633248 0 miRBase 9.0
dre-mir-430b-15 CAGUUGACAUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAGUUGGGGUAG 4 + 11635011 0 miRBase 9.0
dre-mir-430b-16 CAGUUGACAUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAGUUGGGGUAG 4 + 11636751 0 miRBase 9.0
dre-mir-430b-17 CAGUUGACAUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAGUUGGGGUAG 4 + 11638514 0 miRBase 9.0
dre-mir-430b-18 CAGUUGACAUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAGUUGGGGUAG 4 + 11640858 0 miRBase 9.0
dre-mir-430b-5 CAGUUGACAUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAAAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAGUUGGGGUAG 4 - 28590763 0 miRBase 9.0
dre-mir-430b-23 CAGUUGAGGUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGUUG AAAGUGCUAUCAAGUUGGGGUAG 4 + 11637363 0 miRBase 9.0
dre-mir-430b-13 CAGUUGACAUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAGUUGGGGUAG 4 + 11630859 0 miRBase 9.0
dre-mir-430b-2 CAGUUGAGGUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAGUUGGGGUAG 4 + 11631471 0 miRBase 9.0
dre-mir-430b-3 CAGUUGAGGUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAGUUGGGGUAG 4 + 11639104 0 miRBase 9.0
dre-mir-430b-6 CAGUUGACGUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAGAGUAGAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAGUUGGGGUAG 4 + 11628515 0 miRBase 9.0
dre-mir-430b-7 CAGUUGACGUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAGAGUAGAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAGUUGGGGUAG 4 + 11632622 0 miRBase 9.0
dre-mir-430b-8 CAGUUGACGUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAGAGUAGAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAGUUGGGGUAG 4 + 11640254 0 miRBase 9.0
dre-mir-430b-10 CAGUUGACAUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAGUUGGGGUAG 4 + 11625623 0 miRBase 9.0
dre-mir-430b-11 CAGUUGACAUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAGUUGGGGUAG 4 + 11626774 0 miRBase 9.0
dre-mir-430b-12 CAGUUGACAUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAGUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAGUUGGGGUAG 4 + 11629119 0 miRBase 9.0

Download Known miRNA Sequences



TDL, Institute of Biomedical Science, Academia Sinica, Taipei, Taiwan.
Copyright © 2007 TDL. All rights reserved.