miRNA display CGI


Back To miRNA display CGI home

Results 1 - 20 of 337 are showing below:
Show page:

Candidate ID Hairpin Sequence Mature Sequence Chromosome No. Strand Start Length Version
dre-mir-221 GUCGUGAACCUGGCAUACAAUGUAGAUUUCUGUGUGGUACUAUCUACAGCUACAUUGUCUGCUGGGUUUCAGGCCAGCAGAAUAAUUCUGCUC AGCUACAUUGUCUGCUGGGUUUC 0 0 miRBase 9.0
dre-mir-30a GGCUCCUUGCAGUUGUAAACAUUCCCGACUGGAAGUUGUAAUGCAGAAAAUCUCAGCUUUCAGUCUGAUGUUUGCUGCUACUGGUGGCC UGUAAACAUUCCCGACUGGAAG 0 0 miRBase 9.0
dre-mir-430j CAGUUGAGAUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAAUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAAUUGGGGUA 0 0 miRBase 9.0
dre-mir-31 GAAGAGAUGGCAAGAUGUUGGCAUAGCUGUUAAUGUUUAUGGGCCUGCUAUGCCUCCAUAUUGCCAUUUCUG GGCAAGAUGUUGGCAUAGCUG 0 0 miRBase 9.0
dre-mir-139 CUGUAUUCUACAGUGCAUGUGUCUCCAGUGUUUCUAUGGCGACUGGGGAGGCAGCGCUGUUGGAAUAAC UCUACAGUGCAUGUGUCU 0 0 miRBase 9.0
dre-mir-222 GCCGGUGGCUUGUUCGGGUGCUCAUGAGAUGCUCAGUAGUCAGUGUAGAUCCUGUGUCACAAUCAGCAGCUACAUCUGGCUACUGGGUCUCUGAUGGCAUUUUCUGCU AGCUACAUCUGGCUACUGGGUCUC 0 0 miRBase 9.0
dre-mir-739 CGGGUGGAGCCGCCGCGGGCGCAGAUCUUGGUGGUAGUAGCAAAUAUUCAAACGAGAGCUUUGAAGGCCGAAGUGGAGAAGGGUUCCAUGUG AGGCCGAAGUGGAGAAGGGUU Zv6_NA2028 - 214 0 miRBase 9.0
dre-mir-146b-2 GCUCUUGGCUUUGAGAACUGAAUUCCAAGGGUGUCUGCUUUAUAUUCAGCCCACGGAGUUCAGUUCUUAAGUUUGGAUGC UGAGAACUGAAUUCCAAGGGUG Zv6_NA1492 + 4920 0 miRBase 9.0
dre-mir-93 GUGUGUGUUAAAAGUGCUGUUUGUGCAGGUAGUGUGUUUCCUCUACUGUAGGAGCAGCACUUCACAACACACAC AAAAGUGCUGUUUGUGCAGGUA 14 + 100078 0 miRBase 9.0
dre-mir-19d GUUGUGUGGCGGUCAGCUUUGCGGGGUGGGCAGUCAGCCUCCGUGUGGCCGCUGUGCAAACCCAUGCAAAACUGAGCGCUGCGCUAC UGUGCAAACCCAUGCAAAACUGA 14 + 100236 0 miRBase 9.0
dre-mir-25 GCCGGCGCUGAGAGGCGGAGACUUGGGCAGCUGCCGUCAUUCCCAGAAGGCAUUGCACUUGUCUCGGUCUGACAGUGGCGGC CAUUGCACUUGUCUCGGUCUGA 14 + 100343 0 miRBase 9.0
dre-mir-142a CGUACAGUGCAGUCAUCCAUAAAGUAGAAAGCACUACUAAACCCCUCGCCACAGUGUAGUGUUUCCUACUUUAUGGAUGAGUGUACUGUUG CAUAAAGUAGAAAGCACUACU Zv6_NA2000 - 121449 0 miRBase 9.0
dre-mir-199-2 GGAGUUUUUGUGGACGCCCGUCCCGCCUGCCCAGUGUUCAGACUACCUGUUCAGGAAUUAGUGUUUGUACAGUAGUCUGCACAUUGGUUAGGCUGG CCCAGUGUUCAGACUACCUGUUC 5 + 188344 0 miRBase 9.0
dre-let-7e GCUGUUCUUGGGGCUGAGGUAGUAGAUUGAAUAGUUGUGGAGCCCUGCGCUCUCUCUCUGAGAUAACUAUACAAUCUACUGUCUUUCCUAAGGCGACAGC UGAGGUAGUAGAUUGAAUAGUU Zv6_scaffold3754 + 239912 0 miRBase 9.0
dre-let-7a-5 GUACGUGUUUUUGGUGUCUGGACAAGGUGAGGUAGUAGGUUGUAUAGUUUGGUGGGAGGGAUCAAACCCUGUUCAGGUGAUAACUAUACAGUCUAUUGCCUUCCUUGUGUCACCUAAGGUCUGC UGAGGUAGUAGGUUGUAUAGUU Zv6_scaffold3754 + 240110 0 miRBase 9.0
dre-mir-23a-2 CUCUUCUGCCGGCCAGGGGAAUUCCUGGCAGAGUGAUUUUUAAACCUAAUGACUGAAUCACAUUGCCAGGGAUUUCCAAUGGCUCGUGUGACUCAGAG AUCACAUUGCCAGGGAUUUCCA Zv6_NA1101 + 295128 0 miRBase 9.0
dre-mir-27c GGUUGUGUGGUGUCAGGACUUAACCCACUUGUGAACAAUGCAUCGAACUUCAAUGUUCACAGUGGUUAAGUUCUGCCGCCCCUAGACC UUCACAGUGGUUAAGUUCUGC Zv6_NA1101 + 295353 0 miRBase 9.0
dre-mir-24-2 GGGCUGGUCUCCUGUGCCUGCUGUGCUGAUAAUCAGUGGACGGCUGUGACUGGCUCAGUUCAGCAGGAACAGGGGCCUGGUC UGGCUCAGUUCAGCAGGAACAG Zv6_NA1101 + 301880 0 miRBase 9.0
dre-let-7i GUGUACUGGCUGAGGUAGUAGUUUGUGCUGUUGGUUGGGAUGUGACAUUGCCCGUUAUGGAGAUGACUGCGCAAGCUACUCCCUUGCCAGUGCUG UGAGGUAGUAGUUUGUGCUGUU 25 + 485774 0 miRBase 9.0
dre-mir-101b GCUCCUCCGUCAUGAAUUGUCCAUUUUCAGUUAUCAUGGUACCGGUGCUGUGUGCCUGUCAAGUACAGUACUAUGAUAACUGAAGAUUGACAAUGCCAAACAUCAGUGGAGU UACAGUACUAUGAUAACUGAAG 5 + 504812 0 miRBase 9.0

Download Known miRNA Sequences



TDL, Institute of Biomedical Science, Academia Sinica, Taipei, Taiwan.
Copyright © 2007 TDL. All rights reserved.