miRNA display CGI


Back To miRNA display CGI home

Results 1 - 20 of 337 are showing below:
Show page:

Candidate ID Hairpin Sequence Mature Sequence Chromosome No. Strand Start Length Version
dre-mir-222 GCCGGUGGCUUGUUCGGGUGCUCAUGAGAUGCUCAGUAGUCAGUGUAGAUCCUGUGUCACAAUCAGCAGCUACAUCUGGCUACUGGGUCUCUGAUGGCAUUUUCUGCU AGCUACAUCUGGCUACUGGGUCUC 0 0 miRBase 9.0
dre-mir-139 CUGUAUUCUACAGUGCAUGUGUCUCCAGUGUUUCUAUGGCGACUGGGGAGGCAGCGCUGUUGGAAUAAC UCUACAGUGCAUGUGUCU 0 0 miRBase 9.0
dre-mir-30a GGCUCCUUGCAGUUGUAAACAUUCCCGACUGGAAGUUGUAAUGCAGAAAAUCUCAGCUUUCAGUCUGAUGUUUGCUGCUACUGGUGGCC UGUAAACAUUCCCGACUGGAAG 0 0 miRBase 9.0
dre-mir-221 GUCGUGAACCUGGCAUACAAUGUAGAUUUCUGUGUGGUACUAUCUACAGCUACAUUGUCUGCUGGGUUUCAGGCCAGCAGAAUAAUUCUGCUC AGCUACAUUGUCUGCUGGGUUUC 0 0 miRBase 9.0
dre-mir-430j CAGUUGAGAUCAACUCUAACUUUAGCAUCUUUCUUUUAAGCAAAGUAGAAAGUGCUAUCAAAUUGGGGUAGAUGUUUGCUG AAAGUGCUAUCAAAUUGGGGUA 0 0 miRBase 9.0
dre-mir-31 GAAGAGAUGGCAAGAUGUUGGCAUAGCUGUUAAUGUUUAUGGGCCUGCUAUGCCUCCAUAUUGCCAUUUCUG GGCAAGAUGUUGGCAUAGCUG 0 0 miRBase 9.0
dre-mir-216a-2 GCUGAUUUUUGGCAUAAUCUCAGCUGGCAACUGUGAGUAGUGUUUUCAUCCCUCUCACAGGCGCUGCUGGGGUUCUGUCACACACAGCA UAAUCUCAGCUGGCAACUGUGA 22 + 37769991 0 miRBase 9.0
dre-mir-206-2 GAGUUGGCUGUUGCUUAUUGAGACGACAUACUUCCUUAUAUCCCCAUAUUCAGAAUUAAUCUAUGGAAUGUAAGGAAGUGUGUGGCUUCAGUGAGAUCUCAUCAUCAUC UGGAAUGUAAGGAAGUGUGUGG 17 + 5126899 0 miRBase 9.0
dre-mir-216b-2 CUGACUGGGUAAUCUCUGCAGGCAACUGUGAUGUGAUUACAGUCUCACAUUGACCUGAAGAGGUUGUGCAGUCUGU UAAUCUCUGCAGGCAACUGUGA 22 + 37769696 0 miRBase 9.0
dre-mir-217-2 AUGAGAACUUUCUGAUGUUGGUGAUACUGCAUCAGGAACUGAUUGGAUGAUAUUCAGGAGCCAUCAGUUCCUGAUGCACUCCCAUCAGCAUCGAAAGA UACUGCAUCAGGAACUGAUUGG 22 + 37770216 0 miRBase 9.0
dre-mir-204-2 GUGUUGCUCUAGUGACCAGUUUGUGACCUCCUGGGUUUCCCUUUGUCAUCCUAUGCCUGCAGUUCCUGAUGAGGCUGGGACAGCAAAGGGAGGUUCAGAUGUCGACCUGUACUACAGUCAAUAC UUCCCUUUGUCAUCCUAUGCCU 7 + 33297514 0 miRBase 9.0
dre-mir-202 CUGUUCCUUUUUCCUAUGCAUAUACCUCUUUGACAUGCUGCUUUAAAGAGGCAUAGGGCAUGGGAAAAUGGGGCGG AGAGGCAUAGGGCAUGGGAAAA 13 + 57564736 0 miRBase 9.0
dre-mir-200b GGUAGUCGUCUCCAUCUUACGAGGCAGCAUUGGAUUUCAUUACUUUUUCUAAUACUGCCUGGUAAUGAUGAUGAUUGCUGCC UAAUACUGCCUGGUAAUGAUGA 23 + 26312761 0 miRBase 9.0
dre-mir-200a GGCACUUAGCAGCCAUCUUACCGGACAGUGCUGGACUGUAUAACUGUUUUCUAACACUGUCUGGUAACGAUGUUUGUUGGGUGACC UAACACUGUCUGGUAACGAUGU 23 + 26312892 0 miRBase 9.0
dre-mir-196a-2 UCGAGUGGUUUAGGUAGUUUCAUGUUGUUGGGAUUACAUUCAAACUCUGCAACGUGAAACUGUCUUAAUUGCCCCA UAGGUAGUUUCAUGUUGUUGGG 19 + 13914390 0 miRBase 9.0
dre-mir-194b GCUCGCUGGGUGUAACAGCCGCUCCAUGUGGAAAAUGCAUUCAAGUGCCCAUGGAGAAGCUGUUACCUGCAGAGAGU UGUAACAGCCGCUCCAUGUGGA 14 + 90128074 0 miRBase 9.0
dre-mir-194a UGGUGCUGACUGCUUGUAACAGCAACUCCAUGUGGAAGGUUUGUGUCUUCCAGUGGAGCUGCUGUUGCGUGCAGAUAGUCACCA UGUAACAGCAACUCCAUGUGG 10 + 26755494 0 miRBase 9.0
dre-mir-301a-2 GCUGUUAACAGGUGCUCUGACUUCAUUGCACUACUGUAUUGGACAGCUAGCAGUGCAAUAGUAUUGUCAAAGCGUCUGAGAGCAGC CAGUGCAAUAGUAUUGUCAAAG 10 + 33528786 0 miRBase 9.0
dre-mir-338-1 GGUUUCUCCCUGCAACAAUCUCCUGAUGCUGCCUGAGUGUUUUUCUUCCACUCCAGCAUCAGUGAUUUUGUUGCCGGAGGUCACC UCCAGCAUCAGUGAUUUUGUUG 12 + 42871312 0 miRBase 9.0
dre-mir-338-3 GUGUGUGUGUGUGUUUCUGGUGCCUGCUGAGAACAAUAUCCUGAUGCUGAAUGAGUGUGUUGAAGGAAACUCCAGCAUCAGUGAUUUUGUUGCCAGAGGAGCACUUUGGGCAUCCUGUGUAUAU UCCAGCAUCAGUGAUUUUGUUG 12 + 15751785 0 miRBase 9.0

Download Known miRNA Sequences



TDL, Institute of Biomedical Science, Academia Sinica, Taipei, Taiwan.
Copyright © 2007 TDL. All rights reserved.